Home /
Expert Answers /
Biology /
biology-3400-principles-of-genetics-final-study-guide-ii-dna-transcription-translation-1-draw-pa439
(Solved): Biology 3400: Principles of Genetics FINAL STUDY GUIDE II: DNA Transcription \& Translation 1. Draw ...
Biology 3400: Principles of Genetics FINAL STUDY GUIDE II: DNA Transcription \& Translation 1. Draw a diagram representing prokaryotic transcription and translation. Try eukaryotic on the back of this sheet!: 2. Label the diagram of The Central Dogma of Molecular Biology below: 3. Label the DNA structure: 4. Find the start codon AUG and translate the polypeptide, label the introns and exons: CACUUGCAUCCACGGACUAUGCCGAUUCGUUAAUGAAGCUACUAGCAUGCUAGCAUCGA
Expert Answer
Prokaryotic Transcription and Translation: In prokaryotes, such as bacteria, transcription and translation occur simultaneously in the cytoplasm. The process involves the following steps:Transcription:The DNA double helix unwinds, exposing the template strand.RNA polymerase binds to the promoter region on the DNA template strand.RNA polymerase synthesizes a complementary RNA molecule by adding nucleotides according to the base-pairing rules (A-U and G-C).Transcription continues until the RNA polymerase reaches a termination sequence, which signals the end of transcription.