(Solved): Genetics (Transcription & translation) The genetic code is made up of genes. Genes direct the synt ...

Genetics (Transcription & translation) The genetic code is made up of genes. Genes direct the synthesis of proteins which then carry out specific functions within the body. a) Explain how the structure of the DNA molecule enables it to carry out its functions. (3 marks) b) Below is a part of the coding strand of a DNA molecule. Intron u Exon Intron Exon GAACCTACGAGAGATCCTAATGGCATTAGTTGG i) Predict the nucleotide sequence of the pre-mRNA strand mark) ii) Predict the nucleotide sequence of the mature-mRNA strand (1 mark) c) Twenty different amino acids are used for protein synthesis. In theory this would need only 20 codons. However, there are 64 different codons. Explain the use of remaining 44 codons. (2 marks) d) State one enzyme involved in transcription and describe its role (1 mark) Biochemistry Key Terms: enzyme