Home /
Expert Answers /
Biology /
gt-chr-140753000-140753698-5-39-cctacattgctaaaatetaatgggaaagttttaggttctcctataaacttaggaaag-catctcacct-pa236
(Solved): >chr?:140753000-140753698 5'-cctacattgctaaaatetaatgggaaagttttaggttctcctataaacttaggaaag catctcacct ...
>chr?:140753000-140753698 5'-cctacattgctaaaatetaatgggaaagttttaggttctcctataaacttaggaaag catctcacctcatcctaacacatttcaagccccaaaaatcttaaaagcaggttatatagg ctaaatagaactaatcattgttttagacatacttattgactctaagaggaaagatgaagt actatgttttaaagaatattatattacagaattatagaaattagatetettacctaaact cttcataatgcttgctctgataggaaaatgagatctactgttttcctttacttactacac ctcagATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTAC AGTGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTG GATGgtaagaattgaggctatttttccactgattaaatttttggccctgagatgctgctg agttactagaaagtcattgaaggtctcaactatagtattttcatagttcccagtattcac aaaaatcagtgttcttattttttatgtaaatagattttttaacttttttctttaccctta aaacgaatattttgaaaccagtttcagtgtatttcaaacaaaaatatatgtcttataaac agtgtttcatattttattcttaaataaatatgaaccctt-3' Legend: lower case = intron, UPPER case = exon (in this case, exon 15 of the BRAF gene. Bold = CDNA. 1799T>A: missense variant = 'V600?'. Yellow highlighting is the LOCATION where we want the wild- type and mutation detecting FORWARD primers to target, Green highlighting is the LOCATION where we want the REVERSE primer to target. Researchers wish to design a PCR method to screen patient biopsy samples to determine if they contain this mutation (this might help oncologists choose the best treatment for patients). The highlighted regions in the sequence above are the locations where you will be designing two pairs of primers for two separate diagnostic PCR reactions. Note that the yellow primer location is chosen so that the 3' end sits on the potential mutation site - this is because a match/mismatch at this position causes an absolute amplify/don't amplify outcome. Reaction W will be designed to produce a positive PCR product from wild type DNA sequence, Reaction M will only amplify a reaction product if the mutation is present. Which of the following is the correct sets of primers? Select one: O a. REACTION W Forward primer 5'- gattttggtctagctacagt - 3' Reverse primer 5'- gtttgaaatacactgaaact - 3'
>che?:140753000-140753698 catctcaccteatcctaacacatt caagceccaaaatettaaaageaggttatatagg ctaaatagaactaatcattgttetagacatactat,tgactotaagaggaaagatgaagt actatgtttaaagaatateatattacagaattatagaaat.agatctct acetaaact etcagATAFATTTCTTCA'TGAAGACCTCACAGTAAMANTACGTGATTTTGCRCTAGCTAC AGTCNANCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTG GATGgtaagaat tgaggct,at tecactgattaaat tggecotgagatgetgetg agttactagaagtcattgaagtetcaactatagtattteatagttcceagtatteac agtgtteatattetatettaastaatatgaaccott regend: lower cane - intron, UPPER case - exon (An this case, exon 15 of the BRAF' gene. Bold want the ReVERge peimer to target. fewarchers wish to design a fCR method to screen patient biopsy samples to determine if they contain this mutation (this might help oncologists choose the best treatment for patients). The highlighted regloms in the sequence above are the locations where you will be designing two pairs of primers for two separate dagnostic PCl reactions. Note that the yellow primer locotion is chosen so that the 3 ' end sits on the pofential mutation site - this is becouse a match/mismatch at this position causes an absolute armpliby/dont amplify outcome. Reaction W will be designed to produce a positive PCR product from wild type DNA sequence. Peaction M will only amplify a reaction product if the rmutation is present. Whidi of the following is the cored sets of primers? Selectont a REACIIONW Forward primer 5 - gattiggletegctacagt - 3 : Ruverse primet 5 - gttiganstacactgaasct - 3 .