(Solved): Problem 2) You are trying to study a new bacterial strain that you think is causing food poisoning i ...

Problem 2)

You are trying to study a new bacterial strain that you think is causing food poisoning in a nearby community. Your early experiments show that the bacteria make a short peptide toxin, however you are unable to identify the gene that produces the toxin using genome sequencing and homology analysis. It appears to be a novel toxin. Through some more experiments, you identify a transcription factor that affects the toxin producing gene. Using this transcription factor, you perform a series of foot printing and chromatin pulldown experiments to try to identify the toxin gene. When the following sequence shows up on your screen you get excited:

DNA: 5’ – TTTTTCGTCATTCCCTACTGTGTGAGAACATCAGATCCTTCCCAACGCGCCCACACTAATAT -3’

1. Sequencing and footprinting techniques give amazing amounts of information, but these data are complicated. For example, a random sequence may or may not start in register. Similarly, depending on methodology, sequence data may come from the coding or non-coding strand. For a random sample, what percentage of sequences would you expect to be in register? Explain your answer.

b) If the above sequence was from the coding strand, transcribe the messenger RNA sequence that would be generated from this DNA fragment.

c) Annotate both the DNA and RNA sequences with any features of interest/notable sequences that you observe.

d) What is the sequence of the peptide toxin?