(Solved): Suppose a mutagen strikes the DNA above and alters one of the nucleotides creating a "base substitut ...
Suppose a mutagen strikes the DNA above and alters one of the nucleotides creating a "base substitution" mutation. This change results in the specific nucleotide base substitution below as indicated with the underlined nucleotide in the DNA sequence and this substitution also appears in the mRNA following transcription of this gene.
5^(')- AGTGGCACTCCAAATGAGCTCTTCCGCCGCACTCCACCACTTGTCCAACCGTGGTTAGTG-3' a. Can this gene still be transcribed? (Yes or No) b. Can this gene still be translated? (Yes or No) c. If transcription and translation are still possible, write the amino acid sequence below that would correspond to this "base substitution" mutation. d. Would this mutation affect the chemical properties of the protein encoded by this gene? Briefly explain how or how not (be specific).
